The Y chromosome and mitochondrial DNA are unusual. They do not undergo a process known as recombination (where each pair of chromosomes line up next to one-another and shuffle information between them) before being passed down to the next generation in sperm and eggs. Where most of our DNA is a patchwork of that of our ancestors and it becomes impossible to tell which piece of DNA came from which distant ancestor, the Y chromosome is passed down virtually unchanged from father to son down through the generations. The changes that do occur are the small mutations, which can be likened to typos, when the Y chromosome (like all chromosomes) is copied to be passed down to the next generation. We geneticists like these little mutations as they introduce variation in the DNA sequence and allow us to tell Y chromosomes apart. Each man’s Y chromosome will contain within it a record of all the mutations (the overwhelming majority of which occur in the regions between genes and are harmless) that have occurred along his male-line lineage over time and these will be different from those of the next man’s Y chromosome. Mitochondrial DNA is inherited in an equally simple fashion down the female line. Therefore these two pieces are unusual in that they contain relatively simple records of our genetic past—albeit just representing just two of our many ancestors (Figure 11.2).
There are two different commonly used types of marker that we use to tell Y chromosomes apart (Figure 11.3). The first of these are known as binary markers, so called because they come in either one form (allele) or another. The most common type of binary marker that we look at is a Single Nucleotide Polymorphism (SNP—polymorphism meaning many forms). The hundreds of these SNPs now known to exist on the Y chromosome are essentially where there is a change in the base found at a particular location on the Y chromosome.
These types of marker have a very low mutation rate and once such a mutation has occurred in a man’s lineage then this will be passed down to his male-line offspring. These types of mutations happen so
FIGURE 11.2 The Y chromosome and mitochondrial DNA are two sections of our DNA which have a simple pattern of inheritance. The Y chromosome, because it has on it the gene for maleness, is passed on down through the male line only. Mitochondrial DNA is passed down by a mother to all her children but only daughters can pass it on: therefore it is passed down through the generations through the female line only.
Short Tandem Repeat (STR)
Male 1 :AACTGGTCATATTGACCTACTCATCATCATCATCATCATCAGGTAGTTA Male 2 :AAcTaGTCATATTGACCTACTCATCATCATCATCATCATCATCAGGTAGT
FIGURE 11.3 There are two main types of markers that are used to distinguish between Y chromosomes. These are SNPs (Single Nucleotide Polymorphisms) and STRs. A SNP is a single base change, whereas STRs are likened to a stutter in the DNA where a short motif is repeated a number to times; with the number of repeats can differ between individuals.
Slowly that it is possible to draw up a large family tree of Y chromosome types based on these markers. We can use statistical methods based on these mutation rates to place the ancestor of all Y chromosome types found today to be in Africa ~100,000 years ago. Each branch of the tree is determined by a binary marker and each of these branches is further subdivided by more binary markers. Thus it is possible to ‘type’ a man’s Y chromosome type by determining if he is ancestral (has the old form at that particular place on his Y chromosome) or derived (new form, or allele, at that marker) for a number of these different markers and determine which part of the tree his Y chromosome belongs to. The different branches of the tree are broad groups known as haplogroups.
Because of their very slow mutation rate, haplogroups only allow us to discriminate between men at a very broad level: we know for example, that many millions of men will have Y chromosome types that fall into haplogroup R1b for example. Therefore we need a way of differentiating between men at a finer scale and we do this using a type of marker known as an STR (short tandem repeat). This can be likened to a stutter in the DNA sequence where a particular short sequence of bases is repeated many times. A mutational event which gives rise to the deletion or addition of one of these repeated units, as the Y chromosome is being copied to be passed down from father to son, is fairly common and therefore it is possible to find many different alleles for a particular marker (for example, one man may have 12 repeats of a particular order of bases whereas the next man may have 11 repeats and still another may have 14 repeats). There are over a hundred STRs on the Y chromosome and usually many of these markers are typed to generate what can be likened to a Y chromosome fingerprint, known as a haplotype. These two different types of markers, because of their varying mutation rates, can be used in combination to examine events at varying time depths.
World History
